I had a long conversation with Dr. Ketchum. She could not have been nicer. She impressed me with her ability to explain DNA on a simple level I could understand. She even explained several concepts I have been struggling to understand. I’m not a scientist I enjoy philosophy and history, especially ancient history. I have never met someone who has researched and consumed that type of information like I have. I think she has forgotten more than I know. I was beyond impressed. At the moment Dr. Ketchum has prior obligations but I told her the door is always open when she wants to come on.
Dr. Ketchum writes “This video shows how, as scientists, we can determine whether contamination is present in a DNA sample. It also addresses how peer reviewers failed to ask to see the raw data to determine whether or not the Sasquatch DNA samples were contaminated.”
Nick H
Thanks for sharing Wes! Great information, Dr. Ketchum is brave and is a leader on this topic, taking the higher road should serve as an example to her unprofessional peers.
Dr.Ketchum is fighting an uphill battle here, for everyone who takes the time to actually research Sasquatch and do critical thinking, it becomes obvious that this topic is being deliberately swept under the carpet by powerful forces.
As for the unprofessional peer reviewers who deliberately don’t actually serve science, they need to show a bit of testicular fortitude.
Haskell H
As I point out in Chapter 14 of my book, “The Sasquatch Genome Project: A Failed DNA Study,” (pp.155-156):
“The example of interest here is an electropherogram (discussed in Chapter 5) and the corresponding sequence at 30.01 minutes into the video, purportedly from the Sample 140 cytochrome b (cytb) gene. This gene occupies positions 14747 through 15887 of the 16568 bp human mitochondrial genome. I did a BLAST™ search of this purported cytb sequence from the video:
CTTGTGCGGGATATTGATTTCACGGAGGATGGTGG
TCAAGGGACCCCTATCTGAGGGGGGTCATCCATGG
GGGCGAGAAGGGATTTG (shown here for the convenience of those wishing to verify the results below)
with the result of a 100%ID match to the human 16434-16348 minus strand, covering the control region (16434-16384) and the HV-1 region (16383-16348), clearly 461 bp distant from the purported cytb region (14747-15887). Sequences are normally reported as the plus strand for consistency in comparisons, so something is clearly wrong here. Not to mention that the nDNA of S140 was from a dog, (Chapter 4) so human is probably contamination. Pristine electropherograms are not proof of pristine, single species samples, when species specific primers are used. The primed species may be an impurity, as I strongly suspect here.”
The biggest mistake in the Ketchum experimental design was to assume a human like result and to use methodology specific to human samples. In some cases, this simply picked up human contamination, in others it produced the anomalous results found throughout her paper. I find the following Ketchum statements from the paper inconsistent with other results:
“Universal mitochondrial DNA cytochrome b primers for species determination as well as universal mammalian primers
designed for species identification in the hypervariable region 1 were utilized21-28 . All 111 screened samples revealed 100% human cytochrome b and hypervariable region 1 sequences with no heteroplasmic bases that would indicate contamination or a mixture. These samples were then sent out to another laboratory for mitochondrial whole genome sequencing.”
First of all, I find it highly unlikely that 111 unprovenanced samples collected in the woods would all turn out to be human if tested for all mammals. But it is possible. But where are these 222 (2 x 111) sequences? Such important data should have been included in supplemental data. I suspect they don’t exist, or they gave anomalous results like the one in the video. Show us the sequences, Dr. Ketchum? Her paper Supplementary Data 2 table only lists 18 whole mitochondrial genome sequences. What were the other 93 results like? Why aren’t they given equal mention?
On the Sasquatch Genome Project website under Supplemental Raw Data one can download the raw sequence data for Sample 26 mtDNA. It takes special software to view these, which I did. From my book, Chapter 14:
” Unfortunately, the 272 electropherograms contained only 47 that could be assembled into a sequence of 5260 bp out of an expected 16,568 bp human mitochondrial genome. The remaining 225 electropherograms contained only 11 which could be assembled into a 1923 bp sequence. Other incomplete assemblies were shorter still.”
You can view a screen shot of six of the 273 subsequences on the back cover of my book or on Amazon.com if you don’t buy the book: one excellent, one good, two poor, and two very questionable. Furthermore, sequences obtained from this raw data only agreed 96% with her published sequence in the paper. So the results were not even reproducible. Finally, I found black bear NUCLEAR DNA among the raw data Since human MITOCHONDRIAL DNA primers were used, this is prima facie evidence of degradation and self priming, not to mention that the sample IS from a black bear with human contamination.
Don’t be wowed by her video. It’s not typical of her data and does not even come from the reported cytb gene.
Haskell V. Hart
PS I am the “discredited (only by her) physical chemist” referred to by Melba Ketchum in her previous post, but I am not “John.” I never disguise my identity when discussing this subject and expect to be held personally accountable for my posts. Science based criticism is always welcome.
Haskell H
Get off the Ketchum Coolaid, Nick. Do a little research, yourself. Check her sequences out against the database. My book and blog tell you how. Be scientific.
Pete D
Thank you for balancing this one out, it needed it ????
Richard W
Good rebuttal on the part of Dr Ketchum. Thanks Wes.
Maynard w
I really hope she comes on the show.
Jo M
Continue to be impressed with the discussion. Thank you to all for this captivating information.
Amy T
Still Need a Body!
John A
Thank you Haskell
Nathen C
Why will she not come on the show and chill with my homie Wes?
Haskell H
She won’t come on any shows where she might be asked tough questions. She prefers sensationalist shows with known sympathetic hosts who pitch her softball questions, which she hits out of the park, at least in their little minds.